defmodule Bio.IO.Fasta do @moduledoc """ Allow the input/output of FASTA formatted files. The FASTA file format is composed of pairs of lines where the pair is demarcated by the ">" character. All data proceeding the ">" character represents the 'header' of the pair, while the next line after a newline represents sequence data. Any data after subsequent newlines that are _not_ preceded by a second ">" character are assumed to be multi-line data. For example, the following two files would be considered equivalent data: ``` # fasta 1 >header1 atgcatgca ``` and ``` # fasta 2 >header1 atgc atgca ``` The FASTA file format does not specify the type of the data in the sequence. That means that you can reasonably store RNA, DNA, amino acid, or any other sequence using the format. The expectation is that the data is ASCII encoded. The methods in this module do support reading into specified types. See `read/2` for more details. """ @type header :: String.t() @type sequence :: String.t() @type read_opts :: {:type, any()} | {:parse_header, (String.t() -> String.t())} @type fasta_data :: [String.t()] | [struct()] | [{header(), sequence()}] | %{headers: [header()], sequences: [sequence()]} @doc """ Read a FASTA formatted file The `read/2` function returns an error tuple of the content or error code from `File.read`. You can use `:file.format_error/1` to get a descriptive string of the error. You can specify the return type of the contents by using a module which implements the `Bio.Sequential` or equivalent behaviour. Specifically the type must have a `new/2` function for building the struct. The default option for the reader is a special module `Bio.IO.SequenceTuple`, which will return the label and sequence as a tuple of raw binary. See `Bio.IO.SequenceTuple.new/2` for details. ## Options - `:type` - The module for the type of struct you wish to have returned. This should minimally implement a `new/2` function equivalent to the `Bio.Sequential` behaviour. Otherwise the base `Bio.IO.SequenceTuple` is used. - `:parse_header` - A callable for parsing the header values of the FASTA file. Otherwise identity is used and the header is returned as is. ## Examples iex>Bio.IO.Fasta.read("test/fasta/test_1.fasta") {:ok, [{"header1", "ataatatgatagtagatagatagtcctatga"}]} """ @spec read(filename :: Path.t(), opts :: [read_opts]) :: {:ok, any()} | {:error, File.posix()} def read(filename, opts \\ []) do type = Keyword.get(opts, :type, Bio.IO.SequenceTuple) h_fn = Keyword.get(opts, :parse_header, & &1) case File.read(filename) do {:ok, content} -> {:ok, parse(content, "", [], :header, type, h_fn)} not_ok -> not_ok end end @doc """ Produces the same output as `read!/2`, but presumes that the file contents are loaded into a binary. """ def from_binary(contents, opts \\ []) do type = Keyword.get(opts, :type, Bio.IO.SequenceTuple) h_fn = Keyword.get(opts, :parse_header, & &1) {:ok, parse(contents, "", [], :header, type, h_fn)} end @doc """ Read a FASTA formatted file The same as `read/2`, but will raise a `File.Error` on failure. """ @spec read!(filename :: Path.t(), opts :: [read_opts]) :: any() | no_return() def read!(filename, opts \\ []) do type = Keyword.get(opts, :type, Bio.IO.SequenceTuple) h_fn = Keyword.get(opts, :parse_header, & &1) parse(File.read!(filename), "", [], :header, type, h_fn) end @doc """ Write a FASTA file using sequence data. The data type that this function accepts is varied, and may be one of a number of `List`s. Examples of which types are handled: List: ``` elixir # a list of header/sequence tuples [{header(), sequence()}, ...] # a list of header/sequence implicitly paired [header(), sequence(), header(), sequence(), ...] # a list of struct() [%Bio.Sequence._{}, ...] ``` Where `%Bio.Sequence._{}` indicates any struct of the `Bio.Sequence` module or modules implementing the `Bio.Sequential` behaviour. It also supports data in a `Map` format: ``` elixir %{ headers: [header(), ...], sequences: [sequence(), ...] } ``` ## Examples iex> Fasta.write("/tmp/test_file.fasta", ["header", "sequence", "header2", "sequence2"]) :ok Will return error types in common with `File.write/3` """ @spec write(filename :: Path.t(), data :: fasta_data, [File.mode()]) :: :ok | {:error, File.posix()} def write(filename, data, modes \\ []) def write(filename, {header, sequence}, modes) do File.write(filename, ">#{header}\n#{sequence}\n", modes) end def write(filename, [header, sequence], modes) do File.write(filename, ">#{header}\n#{sequence}\n", modes) end def write(filename, data, modes) when is_list(data) do [datum | _] = data data = if is_binary(datum) do data |> Enum.chunk_every(2) else data end data |> Enum.reduce("", &to_line/2) |> then(fn output -> File.write(filename, output, modes) end) end def write(filename, %{headers: headers, sequences: sequences}, modes) do Enum.zip(headers, sequences) |> Enum.reduce("", &to_line/2) |> then(fn output -> File.write(filename, output, modes) end) end defp parse(content, value, acc, _ctx, type, header_fn) when content == "" do # this will be [seq, header] for all the parsed seqs [value | acc] |> Enum.chunk_every(2) |> Enum.reduce([], fn [seq, header], acc -> List.insert_at(acc, 0, apply(type, :new, [seq, [label: header_fn.(header)]])) end) end defp parse(content, value, acc, ctx, type, header_fn) when ctx == :header do <> = content case char do ">" -> parse(rest, value, acc, :header, type, header_fn) c when c in ["\n", "\r"] -> parse(rest, "", [value | acc], :sequence, type, header_fn) _ -> parse(rest, value <> char, acc, :header, type, header_fn) end end defp parse(content, value, acc, ctx, type, header_fn) when ctx == :sequence do <> = content case char do ">" -> parse(rest, "", [value | acc], :header, type, header_fn) c when c in ["\n", "\r"] -> parse(rest, value, acc, :sequence, type, header_fn) _ -> parse(rest, value <> char, acc, :sequence, type, header_fn) end end defp to_line([header, sequence], acc) do acc <> ">#{header}\n#{sequence}\n" end defp to_line({header, sequence}, acc) do acc <> ">#{header}\n#{sequence}\n" end defp to_line(%_{} = datum, acc) do acc <> apply(datum.__struct__, :fasta_line, [datum]) end end